Biotechnology 1. LIC and SLIC cloning Normally you will use a com...

  1. Home
  2. Homework Library
  3. Biology
  4. Biotechnology
  5. Biotechnology 1. LIC and SLIC cloning Normally you will use a com...

QuestionQuestion

Transcribed TextTranscribed Text

Biotechnology 1. LIC and SLIC cloning Normally you will use a commercially available vector suitable for LIC cloning and will only have to think about how you adapt your PCR product to the known vector sequence in order to accomplish your cloning task. Remember “LIC” refers to the procedure where you generate singlestranded complementary overhangs of exactly the same length in vector and insert before annealing the two DNAs. (a) Below is an example of a LIC vector, showing the two ends after linearization with the enzyme Ssp1 (which cuts at 5’ AATATT 3’ in the middle to leave blunt ends). 5’ ……CTGTACTTCCAATCCAAT 3’ 5’ ATTGGAAGTGGATAACGG….. 3’ 3’ ……GACATGAAGGTTAGGTTA 5’ 3’ TAACCTTCACCTATTGCC….. 5’ This particular vector is designed to generate 15nt single-stranded regions. (i) How would you treat the cut vector to generate suitable single-stranded DNA overhangs? (ii) What sequences would you add to the ends of a PCR product to be joined to this vector AND how would you treat the PCR product prior to annealing (to generate suitable single-stranded overhangs)? Show this for each end (use x when the exact sequence is not known or important, e.g. for internal PCR product residues)? (iii) Does LIC cloning allow you to clone your fragment in a specific orientation relative to the vector? Explain. (iv) SpeI may strike you as an unusual choice for an enzyme to cut the LIC vector. Could you design a LIC vector that is linearized by cutting with EcoRI (cuts between G and A in the sequence GAATTC)? If your answer is “yes” then draw out suitable sequences as shown for the SpeI vector above (and say how the suitable single-stranded DNA regions will be exposed). If your answer is “no”, then explain why not. (b) SLIC does not produce single-stranded overhangs of precisely defined length and therefore results in annealed products that may have some gaps or other unusual structures. Consider the two ends of different molecules below that are to be joined by SLIC (DNA A is written above and DNA B is written below). They have 15 identical bps at their ends. 5’ ……..CCACCTCGGAGTCAACCTGCTACGGTCATACCGC 3’ 3’ .……GGTGGAGCCTCAGTTGGACGATGCCAGTATGGCG 5’ 5’ CTACGGTCATACCGCCTGCTTGAGAAGGAC……..3’ 3’ GATGCCAGTATGGCGGACGAACTCTTCCTG….. 5’ Draw the products of annealing these two molecules if the 3’ to 5’ exonuclease treatment removed the following number of nucleotides: 2 (i) 18nt from A and 22nt from B? (ii) 18nt from A and 11nt from B? (iii) Would you expect the junctions shown in your answers to (i) and (ii) to form at high efficiency AND to result in a perfect junction after transformation and amplification (as part of a circular recombinant plasmid DNA)? (c) Below are parts of the sequences of 3 molecules, A, B and C with only the 5’ to 3’ strand shown. A: 5’ ……………..CCACCTCGGAGTCAACCTGCTACGGTCATACCGCACGCACTTCAGT GGTA ATCACATCCCAATCCGCAGCAAAACAAAGAATAACCATGAACCGCTACGCGGTAA GCTCGATGGTGGGGCAAGGATCCTTCGGGTGCGTATACAAGGCGACACGCAAG GACGACAGCAAGGTGGTGGCCATCAAAGTGATCTCCAAGCGCGGAAGAGCCAC GAAAGAGCTGAAGAATTTGCGCAGGGAGTGCGACATTCA……….. 3’ B: 5’……….GGCCCGGCTGAAGCATCCGCACGTCATCGAGATGATCGAGTCCTTCGA GTCGAAGACGGACCTTTTCGTGGTCACTGAGTTCGCGCTGATGGACCTG……… ………………………………………………………………………………….CACCGCTAC CTGTCCTACAATGGAGCCATGGGCGAGGAGCCGGCACGTCGGGTGACCGGGCA TCTGGTGTCCGCTCTGTACTACCTGCATTCAAACCGCATCCTCCACCGGGATCTC AAACCGCAAAACGTGCTGCTCGACAAGAACATGCACGCGAAACTCTGCGACTTT GGACTGGCCCGCAACATGACCCTGGGTACCCA……….. 3’ C: 5’………TGGCGGAGCAGCCGTACGACCATCATGCGGACATGTGGTCACTGGGC TGCATAGCCTACGAAAGCATGGCCGGTCAGCCGCCCTTCTGTGCCAGCTCCAT CCTGCATCTGGTGAAGATGATCAAGCACGAGGACGTCAAGTGGCCGAGCACG CTGACTAGCGAGTGCCGCTCCTTCCTACAGGGCCTGCTTGAGAAGGACCCCG GTCTGCGCATATCCTGGACGCAGCTGTTGTGTCACCCCTTCGTTGA…………. 3’ You want to join A to B with the junction exactly after the bold underlined residue in A and immediately before the first bold underlined residue in B. You also want to join B to C with the junction exactly after the second bold underlined residue in B and immediately before the bold underlined residue in C. You are joining the molecules in the orientations shown. (i) You are going to amplify the appropriate regions of A, B and C by PCR and then join them by SLIC. Considering only the A-B junction what primer sequences are you going to use for the righthand end of A and the left-hand end of B? Write out the entire sequences from 5’ to 3’. 3 (ii) Assuming you design appropriate additional primers for the PCR and perform 3’ to 5’ exonuclease digestion as recommended can you anneal A, B and C products together at the same time or do you need to do sequential reactions? Explain. (iii) If you have made the appropriate PCR products from A, B and C for joining via SLIC but you then consider whether there is any other way you could join these fragments together. What is an alternative method that could be used in vitro (note that you will not have picked sequence overlaps suitable for LIC, so LIC is not the answer)? Explain (very likely with the help of a diagram). 2. Site-directed mutagenesis Please refer to the “Quik-change” site-directed mutagenesis slide at the end of Topic 2. The slide is very condensed and does not fully spell out what is happening. Hence, I am asking you to explain further to check that you understand. Let us call the two primers A and B. (a) The strand synthesized in the first round from primer A is drawn as if it is circular but think about whether the 5’ and 3’ ends are joined together. After the first round the temperature is raised to allow double-stranded DNA molecules to dissociate. Then the temperature is lowered to allow annealing of any complementary sequences. Can the DNA synthesized in round one using primer A act as a template in round 2? Draw a simple picture to explain your answer. (b) Consider the last round of DNA synthesis prior to cutting with DpnI. At what point in the cycle would it be best to stop- after denaturation, after annealing or after DNA synthesis? Explain. (c) For this method would it be a good idea to use a DNA polymerase that has 5’ to 3’ exonuclease activity? Explain. 3. Sequencing longer DNAs (still using dideoxy sequencing) (a) You wish to determine the sequence of a 2.4kb piece of DNA cloned in a plasmid vector of known sequence. You do not know anything about the 2.4kb sequence but you want to be confident at the end that you have exactly the correct DNA sequence. What would you do? Explain step by step and why you choose this approach. (b) You wish to determine the sequence of a 150kb piece of DNA cloned in a plasmid vector of known sequence. You do not know anything about the 150kb sequence. What would you do? Explain step by step and why you choose this approach. Note- you should NOT use the same approach for (a) and (b). (c) When using a shotgun sequencing approach you usually make libraries of fragment clones with a defined size by gel-purifying fragments of that size prior to ligation to a vector. (i) If you did not do that what is the worst problem you think you would encounter in the sequencing project (some ways of making the library may in fact obviate this problem)? Explain what might happen and its full consequences. 4 (ii) The fragments are often generated by sonication. By contrast a genomic BAC library is often made using partial Sau3A digestion. Why isn’t partial Sau3A digestion used to make a shotgun sequencing library? (d) Whole genomes were eventually sequenced by shotgun sequencing using libraries of BACsized insets (>150kb), 10kb and 2kb. If you assembled all sequences obtained you would normally end up with a large number of disconnected “contigs” (continuous sequence) of various lengths. In a separate “finishing” phase you attempt to join those contigs together by performing more sequencing, often by primer walking. Assuming you had labeled and stored all DNA templates used for shotgun sequencing you could go back to these templates for primer walking. Imagine that for one contig you look at one end for sequencing reads close to the end in order to decide whether they come from a template that would be useful; for primer walking. (i) Should the sequence derived from a suitable template go towards the end of the contig (5’ to 3’) or towards the center of the contig? (ii) The very last sequence (all mentioned here are in an appropriate orientation) derives from template 126 from the 2kb library. The next 3 overlapping sequences are numbers 58, 1025 and 29,580, also from the 2kb library. Next, occupying very similar positions are clone 12,340 from the 10kb library and clone 831 from the BAC library. Which clone would you pick for primer walking? Explain. (iii) How far do you think you will have to walk to connect to the next contig? Is there any way you would know (using standard approaches used in this kind of sequencing project). Explain, preferably with a diagram (and certainly not by just quoting a phrase).

Solution PreviewSolution Preview

These solutions may offer step-by-step problem-solving explanations or good writing examples that include modern styles of formatting and construction of bibliographies out of text citations and references. Students may use these solutions for personal skill-building and practice. Unethical use is strictly forbidden.

    By purchasing this solution you'll be able to access the following files:
    Solution.docx.

    $50.00
    for this solution

    PayPal, G Pay, ApplePay, Amazon Pay, and all major credit cards accepted.

    Find A Tutor

    View available Biotechnology Tutors

    Get College Homework Help.

    Are you sure you don't want to upload any files?

    Fast tutor response requires as much info as possible.

    Decision:
    Upload a file
    Continue without uploading

    SUBMIT YOUR HOMEWORK
    We couldn't find that subject.
    Please select the best match from the list below.

    We'll send you an email right away. If it's not in your inbox, check your spam folder.

    • 1
    • 2
    • 3
    Live Chats