Biotechnology
1. Second generation sequencing
Slides 21 and 22 show one way of preparing fragmented DNA for 454 sequencing by adding specific DNA sequences to each end and then amplifying DNA fragments on beads in an emulsion.
Slide 21 is fairly clear but I will just emphasize that in each picture the top strand is going from right to left in the 5â€™ to 3â€™ direction. Consequently you will see that the final product runs 5â€™ to 3â€™ from left to right and is a just one strand going from A through unknown fragment sequence to B.
Here we are going to clarify what is explained on slide 22. That slide may be confusing because 5â€™ to 3â€™ is generally not marked and primer nomenclature is different from slide 21. So we are going to make a new step-by-step version of slide 22 with new nomenclature. We are going to use A and B, as in slide 21, to label the longest strand of the original adapter sequences.
The exact sequence of these regions might be:
A
5â€™ CGTATCGCCTCCCTCGCGCCATCAGXXX 3â€™
and
B
5â€™ CTATGCGCCTTGCCAGCCCGCTCAGXXX 3â€™

which means the 3â€™ region of the single-stranded fragment shown in slide 21 ending at B would be the complement of what is shown above, i.e.
5â€™â€¦..YYYCTGAGCGGGCTGGCAAGGCAAGGCGCATAG 3â€™
Thus, the single-stranded fragments all have a format 5â€™ A- fragment-cB 3â€™
Where cB is the complement of sequence B written above (not B itself)
If you were to do a regular solution PCR reaction to amplify pieces of DNA like the one shown at the bottom of slide 21 you could use primers with sequences similar to the sequences written under A and B above. If the red XXX sequences were the same in both cases you should use only the regions shown in black, Aâ€™ and Bâ€™.
Aâ€™
5â€™ CGTATCGCCTCCCTCGCGCCA 3â€™
Bâ€™
5â€™ CTATGCGCCTTGCCAGCCCGC 3â€™

In emulsion PCR the first step is to hybridize A-B flanked fragments to beads that have millions of oligonucleotides attached.
(a) Should the oligonucleotide sequence attached to the beads be Aâ€™ or Bâ€™ ?
(b) How do you ensure that most beads that hybridize to DNA hybridize to one DNA molecule rather than two or more?
(c) You can then add free Aâ€™, free Bâ€™, DNA polymerase, dNTPs and suitable buffer and form an
emulsion. In the first subsequent round of DNA synthesis (no intervening denaturation or annealing step) what is synthesized? (Explain or draw its structure from 5â€™ to 3â€™).
(d) Next, after denaturation, what long DNA fragment will remain attached to the bead and which will be bead-free but still unable to escape the aqueous droplet?
(e) In the next round of DNA synthesis (after annealing)
(i) what could prime the original DNA fragment that first hybridized to beads?
(ii) are more strands like the original DNA fragment strand (A at the 5â€™end made)? Explain.
(f) After many cycles the emulsion is broken, beads are collected and whatever was not attached to beads is discarded.
(i) What is the structure of the DNA fragments attached to the beads?
(ii) What primer would you use for DNA sequencing?
(iii) With this preparation method will you be able to sequence from both ends of the DNA fragment?
(g) When you sequence with your chosen primer what will be the first seven nucleotides of sequence that you read?
(h) What TWO functions do those first seven nucleotides serve? (In my example I have used XXX meaning that we can choose any particular sequence we want. As a clue, I will say that a sequencing run will involve at least half a million or so distinct sequences but you may only need 50,000 sequences for any one experiment).

2. Comparing sequencing methods
(a) The length of sequence read from any one template for both 454 and Illumina sequencing depends on maintaining synchronous extension of all templates (i.e. that nucleotide is added to almost all copies of a template at each cycle that the correct nucleotide is supplied).
Read lengths are characteristically shorter for Illumina than for 454 sequencing. Why is that? Try to think of at least TWO differences in the sequencing protocols that contribute to this difference.
(b) The number of sequences read in any one run is generally around 100 times more for Illumina than for 454 sequencing. Why is that?
(c) Other methods you will come to later (including â€œPacBioâ€) can give even longer read lengths than 454. Still, using 454 and Illumina as examples of long versus short-read and high versus enormously high capacity (as put forth in (a) and (b) above), which of the two methods would you choose for the following applications:
(i) a complex genome with many repeated sequences (like the human genome) that has never been sequenced before? Explain.
(ii) sequencing DNA from a human cancer (which will contain several different populations of cells with different mutations) to try to chronicle which mutations in protein-coding genes are present?
Explain.
(d) Imagine you have just cloned a complicated DNA construct of total length 12kb. You know the intended sequence but you want to check that it is exactly right. How would you obtain its sequence? (A single sequencing run for 454 or Illumina contracted out as a service will likely cost at least $1,000 and take several days to be completed). Explain.
3. Characterizing RNAs
For many years a lot of effort was devoted to making many full-length cDNA libraries in order to sequence the cloned cDNAs and therefore deduce the precise structure of mRNAs. The ultimate objective would be to describe all mRNA species that are made.
(a) In constructing cDNA libraries there is often a normalization step.
(i) What does this achieve?
(ii) If you sequence 10,000 clones from a normalized cDNA library do you think you will learn much about cDNA splicing?
(b) In an effort to catalog all species of mRNA why is it important to sequence cDNAs derived from multiple tissues or even different developmental stages?
(c) For the objective named in (b) is it better to use an RNA sample to make a cDNA library for sequencing clones or to perform RNASeq on the RNA? Explain.

Biotechnology 1. Second generation sequencing Slides 21 and 22 sh...