Answer the questions with key words and brief explanations. Use graphs if you prefer.

1. (20 pts) Describe 5 mechanisms that regulate the activity of a transcription factor.

2. A gene X contains the following piece of sequence close to the transcription starting site.
5’ - CCTCCAAAGAAGAAAAGGAAGGTC - 3’

a. (5 pts) Write the mRNA sequence in 5’ to 3’, translate into amino acid sequence in N- to C- terminal (codon table is on the back of your textbook cover).
b. (5 pts) You are using immunofluorescence staining to visualize this protein in the cell. Predict the subcellular localization of this protein. (refer Table 15-3 and lecture slides)
c. (10 pts) Design an experiment to test the hypothesis that this sequence is sufficient for directing the protein transport.
d. (20 pts) In a point mutation the underlined “A” is changed to “C”. Re-write the amino acid sequence, and predict the subcellular localization of the mutated protein.

3. (40 pts) A type of cell contains a specific transmembrane glycoprotein on the plasma membrane. Describe step by step how this protein is produced and transported in cell (gene -> mRNA -> translation -> modification -> sorting -> transport -> cell membrane). For each step, specify the name of the step, “where”, and the key factors that participate in.

a. Transcription and mRNA processing
b. Protein synthesis
c. Protein modification, sorting and transport

4. (50 pts) In a disease, the un-normal accumulation of acetylcholine in the neuromuscular junction causes skeleton muscle spasm. You are developing a drug to release this symptom. List 5 reasonable strategies that the drug can be designed. Describe the target, drug effect to the target (activate or inhibit the target?), and the consequence. (designing more will obtain extra credits!)

Answer the questions with key words and brief explanations. Use gra...