Answer the questions with key words and brief explanations. Use gra...

Question
Answer the questions with key words and brief explanations. Use graphs if you prefer.

1. (20 pts) Describe 5 mechanisms that regulate the activity of a transcription factor.

2. A gene X contains the following piece of sequence close to the transcription starting site.
5’ - CCTCCAAAGAAGAAAAGGAAGGTC - 3’

a. (5 pts) Write the mRNA sequence in 5’ to 3’, translate into amino acid sequence in N- to C- terminal (codon table is on the back of your textbook cover).
b. (5 pts) You are using immunofluorescence staining to visualize this protein in the cell. Predict the subcellular localization of this protein. (refer Table 15-3 and lecture slides)
c. (10 pts) Design an experiment to test the hypothesis that this sequence is sufficient for directing the protein transport.
d. (20 pts) In a point mutation the underlined “A” is changed to “C”. Re-write the amino acid sequence, and predict the subcellular localization of the mutated protein.

3. (40 pts) A type of cell contains a specific transmembrane glycoprotein on the plasma membrane. Describe step by step how this protein is produced and transported in cell (gene -> mRNA -> translation -> modification -> sorting -> transport -> cell membrane). For each step, specify the name of the step, “where”, and the key factors that participate in.

a. Transcription and mRNA processing
b. Protein synthesis
c. Protein modification, sorting and transport

4. (50 pts) In a disease, the un-normal accumulation of acetylcholine in the neuromuscular junction causes skeleton muscle spasm. You are developing a drug to release this symptom. List 5 reasonable strategies that the drug can be designed. Describe the target, drug effect to the target (activate or inhibit the target?), and the consequence. (designing more will obtain extra credits!)
Solution Preview

These solutions may offer step-by-step problem-solving explanations or good writing examples that include modern styles of formatting and construction of bibliographies out of text citations and references.
Students may use these solutions for personal skill-building and practice.
Unethical use is strictly forbidden.

This is only a preview of the solution.
Please use the purchase button to see the entire solution.
By purchasing this solution you'll be able to access the following files:
Solution.docx
Purchase Solution
$25.00 $12.5
Google Pay
Amazon
Paypal
Mastercard
Visacard
Discover
Amex
View Available Biology Tutors 641 tutors matched
ionut
Ionut
(ionut)
Master of Computer Science
Hi! MSc Applied Informatics & Computer Science Engineer. Practical experience in many CS & IT branches.Research work & homework
5/5 (6,804+ sessions)
1 hour avg response
$15-$50 hourly rate
Pranay
(math1983)
Doctor of Philosophy (PhD)
Ph.D. in mathematics and working as an Assistant Professor in University. I can provide help in mathematics, statistics and allied areas.
4.6/5 (6,688+ sessions)
1 hour avg response
$40-$50 hourly rate
Leo
(Leo)
Doctor of Philosophy (PhD)
Hi! I have been a professor in New York and taught in a math department and in an applied math department.
4.9/5 (6,435+ sessions)
2 hours avg response

Similar Homework Solutions