Bioinformatics - Access the National Center for Biotechnology Info...

  1. Home
  2. Homework Library
  3. Biology
  4. Genetics
  5. Bioinformatics - Access the National Center for Biotechnology Info...

QuestionQuestion

Bioinformatics
- Access the National Center for Biotechnology Information (NCBI) website.
- Locate two bioinformatics tools.
- Determine the identity of two sequences listed in the University of Phoenix Material: Gene Sequences, using BLAST from the NCBI website.
- Write a 350- to 700-word summary of the two tools you investigated and your BLAST findings.
Gene Sequences
Use the following gene sequences for the Bioinformatics assignment in Week Five by entering them in the BLAST tool at the National Center for Biotechnology Information website. After accessing the website, select “Blast” found at the bottom of the page under the “Popular” tab. Then, select a BLAST program to run found under the “Basic Blast” heading. From here, enter the sequences below, and query by selecting “Blast” to determine the identities.
1. CCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGG
2. TCTGCAATTGCTTAGGATGTTTTTCATGAA
3. ACCTGTAGCACAAGAGGCCTTAAAAAAGGAACTTGAAACTCTAACCACCAACTACCAGTG
4. GTGGTGTTTT TATCTGTGCT TCCCTATGCA CTAATCAAAG GAATCATCCT CCGGAAAATA
5. ACTGGCACGCGACGAGGACGCATTCCAAATCATACT
6. GAGGCACTTGGACTTCCTGGACATCCTCCTCTTTGCCAAAATGGAGAATGGGAAGGGCTT
7. GTCCAGCATTCTCCAAAGGTTCAGGTTTACTCCCGTCACCCAGCAGAGAATGGAAAGCCA

Solution PreviewSolution Preview

These solutions may offer step-by-step problem-solving explanations or good writing examples that include modern styles of formatting and construction of bibliographies out of text citations and references. Students may use these solutions for personal skill-building and practice. Unethical use is strictly forbidden.

The National Center for Biotechnology Information (NCBI) website provides a wide variety of data analysis tools that allow users to manipulate, align, visualize and evaluate biological data. All of those can be an invaluable tool to biomedical researchers in many different disciplines. I explored two of them: The Open Reading Frame Finder (ORFF) and COBALT (Constraint-based Multiple Alignment Tool...

By purchasing this solution you'll be able to access the following files:
Solution.docx.

$63.00
for this solution

or FREE if you
register a new account!

PayPal, G Pay, ApplePay, Amazon Pay, and all major credit cards accepted.

Find A Tutor

View available Genetics Tutors

Get College Homework Help.

Are you sure you don't want to upload any files?

Fast tutor response requires as much info as possible.

Decision:
Upload a file
Continue without uploading

SUBMIT YOUR HOMEWORK
We couldn't find that subject.
Please select the best match from the list below.

We'll send you an email right away. If it's not in your inbox, check your spam folder.

  • 1
  • 2
  • 3
Live Chats