Record results & prepare data for analysis of phenotype-gen...

  1. Home
  2. Homework Library
  3. Biology
  4. Genetics
  5. Record results & prepare data for analysis of phenotype-gen...

QuestionQuestion

Record results & prepare data for analysis of phenotype-genotype association
TABLE III-1. Record your phenotype and genotypes in the following table
Phenotype:
Taster                Non-Taster
Genotype at Gene A:
A1/A1                A1/A2          A2/A2
Genotype at Gene B:
B1/B1                B1/B2          B1/B3          B2/B2          B2/B3          B3/B3
Your lab instructor will collect data from your session using tally marks:
TABLE III-2. Genotype counts for each phenotype
            A1/A1    A1/A2    A2/A2    B1/B1   B1/B2   B1/B3   B2/B2    B2/B3    B3/B3   Sum
Taster
Non-Taster
Sum

To increase statistical power of detecting genotype-phenotype associations, phenotype and genotype counts from all sessions will be combined into the following two tables:

TABLE III-3. Genotype counts at Locus A for each phenotype
                  A1/A1    A1/A2      A2/A2    Row Sum
Taster            53         20            39            112
Non-Taster    17          9             52             78
Column Sum 70       29            91            190

TABLE III-4. Genotype counts at Locus B for each phenotype
                   B1/B1    B1/B2    B1/B3    B2/B2    B2/B3    B3/B3    Row Sum
Taster             13         10          11          49          9          1             93
Non-Taster       12          5            1          38          10          1             67
Column Sum    25       15          12         87          19          2             160
Continue to the website to perform the phenotype-genotype association test.


DNA sequence: is it locus A or locus B?
TNTTCGTTTCTCTTCTGCTATCTGTGGTCTGTGCCTCCTTTCCTATTGTTTCTGGTTTCTTCTGGGATGCTGACTGTCTCCCTGGGAAGGCACATGAGGACAATGAAGGTCTATACCAGAAACTCTCGTGACCCCAGCCTGGAGGCCCACATTAAAGCCCTCAAGTCTCTTGTCTCCTTTTTCTGCTTCTTTGTGATATCATCCTGTGCTGCCTTCATCTCTGTGCCCCTACTGATTCTGTGGCGCGACAAAATAGGGGTGATGGTTTGTGTTGGAATCCAAAAAAGGGGCGGGGGGGCTGAGCACGCGCGGCAGAGAGGAAAAATGGGCTCGGGCGCCTGAGGGGGCAGAGATGCCTCCCAAAGCGCCTCGGGAGATGGGGAGGGTAGCCAACGCAAGGGAAAAAAGGTGGGATGTGCTCTCCCCAAAAAACCCTCTCCTCCCCTTCTTTTGTGGGGGTTAGATGACGAAACGAGGTGGAGGGTTCTTGCCTCCACCTCTTTTCCTCAGTCGACGGGGTGCTGATGGTCACCGTGGAAGAAGCTGAGGAGACAAACTCCTCCCTCCGAGGCACAAAGAGAAAGGTGGCTGCCTCTCTCTGAGGGCGAGAGAGAGCGCCGTAAAAGAGTA

Solution PreviewSolution Preview

These solutions may offer step-by-step problem-solving explanations or good writing examples that include modern styles of formatting and construction of bibliographies out of text citations and references. Students may use these solutions for personal skill-building and practice. Unethical use is strictly forbidden.

Genome-Wide Association Study (GWAS) was applied to test if any of two possible genes is associated with the ability to sense some taste. The frequencies of two alleles on Locus A (A1 and A2) and B (alleles B1, B2, B3) among 190 and 160 individuals were recorded. The genotype data were matched with the phenotypes – Tasters and Non-Tasters. The aim of the work was to determine if there is a correlation between the genotype and phenotype, precisely between gene A and gene B alleles’ presence and the ability to taste. Another aim was to find the gene responsible for this phenotype by searching online databases.
In the first part, the phenotype-genotype correlation was analyzed by constringency table method. In this method, the relationship between two parameters is being tested [1] – here phenotype and genotype. Parameters of this analysis (observed counts, expected counts, the degree of freedom, chi-squared) are used to test the null hypothesis. It is the statement that there is no relationship between two measured phenomena or there is no significant difference between specified populations. This means that any observed difference is due to sampling or experimental error [2]. Here, the null hypothesis for both constringency tests (for Locus A and B) are that there is no correlation between the taste sensing and genotype of loci A and B.
The p-value was used to determine if the null hypothesis is true. Probability or p-value is the probability for a phenomenon to be observed if the null hypothesis is true. More specifically it is the probability for a given statistical model that if the null hypothesis is true, the statistical summary would be the same...

By purchasing this solution you'll be able to access the following files:
Solution.docx and Solution.xlsx.

$58.00
for this solution

or FREE if you
register a new account!

PayPal, G Pay, ApplePay, Amazon Pay, and all major credit cards accepted.

Find A Tutor

View available Genetics Tutors

Get College Homework Help.

Are you sure you don't want to upload any files?

Fast tutor response requires as much info as possible.

Decision:
Upload a file
Continue without uploading

SUBMIT YOUR HOMEWORK
We couldn't find that subject.
Please select the best match from the list below.

We'll send you an email right away. If it's not in your inbox, check your spam folder.

  • 1
  • 2
  • 3
Live Chats