a. (3 pts) Preceding gel electrophoresis, name three functions of a...

  1. Home
  2. Homework Library
  3. Biology
  4. Genetics
  5. a. (3 pts) Preceding gel electrophoresis, name three functions of a...

QuestionQuestion

Transcribed TextTranscribed Text

a. (3 pts) Preceding gel electrophoresis, name three functions of adding loading dye to your sample. b. (3 pts) Prior to loading restriction fragments into a gel, they should be heated in a 60oC water bath for a few minutes. Why? Youareattemptingtofullydigest5μgoflDNAinatotalreactionvolumeof100μlusingHindIII. Youare planning on a 30 minute digestion at 37oC. a. (3 pts) How many units of HindIII do you need? b. (3 pts) The HindIII solution you purchased states that the concentration is 5 units/μl. What is the volume of HindIII solution that you must add to your reaction mix? a. (3 pts) Following the transformation of E. coli with a plasmid containing the gene for Kanamycin resistance, the cells are incubated in a recovery broth prior to plating on selective growth media which contains Kanamycin. Why wouldn’t you include Kanamycin in the recovery broth since transformants would already contain the Kanr gene? b. (4 pts) In the isolation of plasmid DNA from E. coli, what are the functions of the following: sodium hydroxide; SDS; potassium acetate solution? (15 pts) Answer the bulleted questions below. While cleaning out your lab freezer, you find a microfuge tube labelled “HDR template Chromosome IV”, and the following sequence printed in tiny (very tiny) letters: GATTGTGATGACCCGCAATGTGAATTACAATTTCTGAGTAAGAAAACAGATGGAAGGGGATACATTCATAGGGAATTG CTATTTTTCACCCGGCAAAATATACATATATACGTGGAAAATCGGGAAGTTGAGAGCTATAATATGAATATACAAAATA ATCGAACAATAGTTT You can’t remember what gene, or even which organism this was for, but you do know that it was for a CRISPR-cas9project(itsayssoonthemicrofugetube...intinywriting). Youdon’twanttojustthrowitout, so you decide to figure out which organism and gene this template is for. You seem to recall that there is a great online database that you can use for this (yes, you should use it). Once you find some info on the gene, you decide that you have nothing better to do than to figure out which CRISPR site the original researcher may have chosen within the range of this template. So, you recall from a class you once took that youcanuseawebsitetofindCRISPRcutlocations.Butwait,there’smore...Yourcuriosityleadsyouto figuring out what modification the HDR template is supposed to make in the gene. Excited to show the PI how smart you are, you write an email explaining the following... • What organism and gene is this template for? • What is the likely CRISPR (crRNA) sequence that was chosen? • What minor modification will the HDR template make to the original gene sequence? You get a response a few minutes later reprimanding you for wasting time on this while you should be cleaning the freezer and she explains that the template was abandoned because the previous lab tech forgot toaddacriticalchangetotheHDRsequencewhendesigningitanditcannotbeusedinvivo. Shegoesonto explain that you can keep your job if you figure out what the design error was. • What was the design error in the HDR template? 5. (11 pts) You wish to perform PCR on a DNA sample to amplify a 1.5kbp DNA fragment using the following: Fwd Primer:5’-CTCGATGCTGAGCGTCGGCGC-3’ Tm=63oC; concentration=4μM Rev Primer: 5’-CGTGCACGATCGCACGGTAGC-3’ Tm=62oC; concentration=4μM DNA template: concentration=0.25μg/μl; GC=67% AmpliTaq Gold 360 MasterMix (GC enhancer is available) a. List all of the components and their volumes that you will add to the PCR tube for a final reaction volume of50μl. b. Devise a COMPLETE thermocycling protocol that would have a high chance of theoretically working for the template/components you are using. Show me all times and temperatures that you would program into the thermocycler. 6. (5 pts) In the alkaline lysis method used in lab to isolate plasmid DNA from intact bacterial cells, how is the genomic DNA eliminated but the plasmid DNA is retained? Describe how/why this occurs. 7. (5 pts)Our pCAS plasmid is shipped in a transformed E. coli culture and we need to extract it from the cells before performing whole-plasmid PCR. Following this PCR, the contents of the PCR tube are to be digested with the restriction enzyme DpnI before being clean with the PCR cleanup kit. Why are we performing this DpnI digestion? 8. (5pts)WeusedtwodifferentDNApolymerasemastermixesfortheamplificationsweranthissemester (AmpliTaq Gold 360, and Phusion Hot Start II. Describe some of the major differences between these two polymerases in terms of function, activation, thermocycling times/temperatures, etc. 9. (6 pts) Given the following gene sequence, you wish to isolate only the DNA in bold nucleotides using PCR. All bold NT must be included and nothing more or less. This is a sequence directly as given at NCBI. a. What is the sequence of the two 20-base primers you would order (written 5’ à 3’)? b. What will be the exact size of your isolated fragment? 10. (8pts)Youwouldliketoperforminvitrotranscriptionoftheanti-sense(minus)strandfromthegene sequence isolated above. You will be using T7 RNA polymerase which recognizes the following promoter sequence: 5′- TAA TAC GAC TCA CTA TAG GG -3′. a. DescribehowyouwouldaddthepromotertotheDNAfragmentyouhavealreadyisolatedinthe previous question. (Note: Anti-sense strand transcription only). Be as detailed as possible. b. What is the exact size of the transcribed RNA assuming there is no early transcription termination? 11. (7pts)Createarestrictionmap:AlinearDNAmoleculeisdigestedwiththreerestrictionenzymes independently and in tandem, resulting in the following fragments (in kbp) based on band migration and interpretation: EcoRI BamHI HindIII EcoRI + BamHI EcoRI + HindIII BamHI + HindIII 586316 6 14 16 5 5 8 11 611 8 12. (7pts)Createarestrictionmapofthisplasmid:Aplasmidisdigestedwiththreerestrictionenzymes independently and in tandem, resulting in the following fragments (in kbp) based on band migration and interpretation: EcoRI BamHI HindIII EcoRI + EcoRI + BamHI + BamHI HindIII HindIII B+H+E 2 4 5 6 7 24 11 11 2 4 5 13 13 9 9 6 13 11 7 13. (12 pts) The gel below represents the results of the digestion of linear DNA using two restriction enzymes as follows: Lane 1 = DNA ladder Lane 2 = DNA + EcoRI Lane3=DNA+BamHI Lane4=PDNA+EcoRI+BamHI The size of the fragments in the ladder are listed in the table below. a. Measure the migration distance of each DNA fragment. b. Using Excel or other similar software, plot the measured migration distance of the DNA ladder fragments and make a trend line through the points. Attach the graph. c. Determinethesizeofthefragmentsproducedbythethree digestions using the trendline formula (Lanes 2, 3, & 4) d. What is the approximate size of the DNA used in this experiment? e. Make a restriction map of the DNA based on these results. DNA Ladder Lane 2 (EcoRI) Lane 3 (BamHI) Lane 4 (EcoRI+BamHI) Migration Distance Fragment Size (bp) 21941 13872 11610 7778 5449 3990 2795 961 769 Migration Distance Fragment Size (bp) Migration Distance Fragment Size (bp) Migration Distance Fragment Size (bp)

Solution PreviewSolution Preview

These solutions may offer step-by-step problem-solving explanations or good writing examples that include modern styles of formatting and construction of bibliographies out of text citations and references. Students may use these solutions for personal skill-building and practice. Unethical use is strictly forbidden.

    By purchasing this solution you'll be able to access the following files:
    Solution.docx.

    $150.00
    for this solution

    or FREE if you
    register a new account!

    PayPal, G Pay, ApplePay, Amazon Pay, and all major credit cards accepted.

    Find A Tutor

    View available Genetics Tutors

    Get College Homework Help.

    Are you sure you don't want to upload any files?

    Fast tutor response requires as much info as possible.

    Decision:
    Upload a file
    Continue without uploading

    SUBMIT YOUR HOMEWORK
    We couldn't find that subject.
    Please select the best match from the list below.

    We'll send you an email right away. If it's not in your inbox, check your spam folder.

    • 1
    • 2
    • 3
    Live Chats