Watch the Panopto video. Then, design a set of primers to carry out...

  1. Home
  2. Homework Library
  3. Biology
  4. Microbiology
  5. Watch the Panopto video. Then, design a set of primers to carry out...

QuestionQuestion

Watch the Panopto video. Then, design a set of primers to carry out a site-directed mutagenesis experiment as described.
1. The ndmB gene sequence is given below. Design a set of primers to remove the NdeI restriction site in the gene through site-directed mutagenesis.
ATGAAAGAACAGCTCAAGCCGCTGCTAGAAGACAAGACTTACCTTCGCCACTTCTGGCATCCCGTGTGTACCCTTAA
TGAATTCGAACGCGCCAACGCCAGTGGGCACGGCCCCATGGGCGTCACCTTGCTAGGCGAGAAATTGGTGTTGGCCA
GGTTAAATTCAAAGATCATTGCGGCTGCTGACCGATGTGCTCATCGATCGGCACAGCTCTCCATCGGTCGCGTTTGC
AGCAACGCCGGAAAGGACTATCTCGAATGCCCGTATCACGGCTGGCGCTACGATGAGGCTGGGGCCTGTCAACTGAT
CCCTGCTTGCCCTGACAAAAGCATCTCTCCTCGGGCCAAGATTTCCTCATTCGATTGTGAGGTGAAATACGACATCG
TGTGGGTACGGCTGGATAACAGCTTCGATTGCACTCAGATTCCATACCTCAGCGATTTCGATAATCCCGACATGCAG
GTAATCGTTGCCGATTCGTATATTTGGGAGACTGTTGCCGAGCGGCGGTGGGAGAACTTTACAGATTTTTCGCACTT
TGCCTTCGTACACCCAGGGACGCTCTATGATCCGTTTTTCGCTAGCCACCCAACTGTTTACGTGAATCGCGTTGATG
GTGAGTTGCAATTCAAACTCGCTCCGCCGCGTGAAATGAAAGGCATCCCGCCAGAAGCACCGATGGGTGACTTCACC
TACCGCTGCACAATGCCGTATTCAGTAAATCTTGAAATCAAATTGTGGAAAGATGACTCACGTTTCGTTCTTTGGAC
TACCGCTAGCCCTGTCGATAACAAGTCTTGCCGGAATTTTATGATTATTGTGCGTGAGAAGGATAATCAACCTGATC
ATATGCACCTGGCTTTCCAGAAGCGGGTGCTTGACGAAGACCAGCCTGTTATCGAATCGCAATGGCCTCTCGAAATA
CAGACCTCGGAAGTCTCCGTTGCAACCGATAAAATTTCCGTCCAGTTCCGCAAATGGCATAAAGAGCTATCTCTGTC
AGCCGTTGAAGGACGGGAGGCGTTCCGCGATTCCGTCTTGACGAATGTTATTGAAGAAGAACAGTAA

Solution PreviewSolution Preview

These solutions may offer step-by-step problem-solving explanations or good writing examples that include modern styles of formatting and construction of bibliographies out of text citations and references. Students may use these solutions for personal skill-building and practice. Unethical use is strictly forbidden.

Sequence recognized by NdelI.
TTTTATGATTATTGTGCGTGAGAAGGATAATCAACCTGATCAT...

By purchasing this solution you'll be able to access the following files:
Solution.docx and Solution1.docx.

$20.00
for this solution

or FREE if you
register a new account!

PayPal, G Pay, ApplePay, Amazon Pay, and all major credit cards accepted.

Find A Tutor

View available Microbiology Tutors

Get College Homework Help.

Are you sure you don't want to upload any files?

Fast tutor response requires as much info as possible.

Decision:
Upload a file
Continue without uploading

SUBMIT YOUR HOMEWORK
We couldn't find that subject.
Please select the best match from the list below.

We'll send you an email right away. If it's not in your inbox, check your spam folder.

  • 1
  • 2
  • 3
Live Chats