QuestionQuestion

Lab #1 “Sequence, PCR amplification, and analysis of a gene encoding a designed inhibitor of SARS CoV-2 entry”.

You are working at a biotech company and have identified a protein that you and your colleagues believe inhibits SARS-CoV-2 entry. You wish to amplify the gene, sequence it, and run it on an agarose gel.

The anticipated sequence of this gene is below (5’-3’; 719 nucleotides in length):

ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCGGCTACGGCCTGCAGTGCTCGCCCGCTACCCCGACCACATGAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAAACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTACCAGTCCGCCCTGAGCAAAGACCCCACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGA

ATG = start codon
TAA = stop codon

1. Provide sequences for two primers (forward and reverse) you would purchase in order to amplify this gene. Note: PCR primers are typically 20 nucleotides long).

2. Provide sequences for primers you would use to sequence the above gene. Note: assume that sequencing typically fails after 200 nucleotides (the polymerase sort of quits). Primers are typically 20 nucleotides long.

3. Using the PCR amplicon generated in #2, describe how you would characterize this DNA by agarose gel electrophoresis

Solution PreviewSolution Preview

These solutions may offer step-by-step problem-solving explanations or good writing examples that include modern styles of formatting and construction of bibliographies out of text citations and references. Students may use these solutions for personal skill-building and practice. Unethical use is strictly forbidden.

The plus strand is:
5’ ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCGGCTACGGCCTGCAGTGCTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTACCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACAT GGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA 3’

Reverse primer PCR (yellow) = 20 nucleotides, Tm =63 ° C, GC content= 45%...

By purchasing this solution you'll be able to access the following files:
Solution.docx.

$15.00
for this solution

PayPal, G Pay, ApplePay, Amazon Pay, and all major credit cards accepted.

Find A Tutor

View available Molecular Biology Tutors

Get College Homework Help.

Are you sure you don't want to upload any files?

Fast tutor response requires as much info as possible.

Decision:
Upload a file
Continue without uploading

SUBMIT YOUR HOMEWORK
We couldn't find that subject.
Please select the best match from the list below.

We'll send you an email right away. If it's not in your inbox, check your spam folder.

  • 1
  • 2
  • 3
Live Chats