QuestionQuestion

1) Assuming that the set of possible list values is {a, b, c, d}, sort the following list in alphabetical order by the distribution-counting algorithm: Use the following modified list: a, b, a, d, c, b, b, c.

2) Consider the problem of searching for genes in DNA sequences using Horspool’s algorithm. A DNA sequence is represented by a text on the alphabet {A, C, G, T}, and the gene or gene segment is the pattern.
A) Construct the shift table for the following gene segment of your chromosome:
Use the following modified search pattern: TCCTATTC
B) Apply Horspool’s algorithm to locate the above pattern in the following DNA sequence:
TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT

3) Draw the B-tree obtained after inserting 35 and then 39 in the B-tree in Figure 7.8. Assume that a leaf cannot contain more than three items.

4) Solve the instances 4, 7, 2, 6, 5 of the coin-row problem.

5) Apply the dynamic programming algorithm to find all the solutions to the change-making problem for the denominations 1,2,3/ 1, 3, 5 and the amount n=9.

Solution PreviewSolution Preview

These solutions may offer step-by-step problem-solving explanations or good writing examples that include modern styles of formatting and construction of bibliographies out of text citations and references. Students may use these solutions for personal skill-building and practice. Unethical use is strictly forbidden.

    By purchasing this solution you'll be able to access the following files:
    Solution.docx.

    $27.00
    for this solution

    or FREE if you
    register a new account!

    PayPal, G Pay, ApplePay, Amazon Pay, and all major credit cards accepted.

    Find A Tutor

    View available Data Structures and Algorithms Tutors

    Get College Homework Help.

    Are you sure you don't want to upload any files?

    Fast tutor response requires as much info as possible.

    Decision:
    Upload a file
    Continue without uploading

    SUBMIT YOUR HOMEWORK
    We couldn't find that subject.
    Please select the best match from the list below.

    We'll send you an email right away. If it's not in your inbox, check your spam folder.

    • 1
    • 2
    • 3
    Live Chats